-
Purpose(Empty Backbone) Express gene of interest under PGK (phosphoglycerate kinase I) promoter
-
Depositing Lab
-
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72268 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCDH-CMV-MCS
-
Backbone manufacturerSystembio
- Backbone size (bp) 6396
-
Modifications to backboneClaI-SalI fragment was replaced with PGK promoter
-
Vector typeMammalian Expression, Lentiviral
- Promoter PGK
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer AGTGAACGGATCTCGACGGT
- 3′ sequencing primer CAACACCACGGAATTGTCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-PGK was a gift from Kazuhiro Oka (Addgene plasmid # 72268 ; http://n2t.net/addgene:72268 ; RRID:Addgene_72268)