-
Purpose(Empty Backbone) Express gene of interest under CB promoter
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 72267 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCDH-CMV-MCS
-
Backbone manufacturerSystembio
- Backbone size (bp) 6677
-
Modifications to backboneClaI/SalI fragment was replaced with CB promoter + MCS
-
Vector typeMammalian Expression, Lentiviral
- Promoter chicken beta-actin + CMV enhancer
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer CGGTGGTGGTGCAAATCAAA
- 3′ sequencing primer CAACACCACGGAATTGTCAG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDH-CB was a gift from Kazuhiro Oka (Addgene plasmid # 72267 ; http://n2t.net/addgene:72267 ; RRID:Addgene_72267)