pLX311-GFP-MEKDD
(Plasmid #194882)

• Purpose: Expression of dominant negative MEK1
• Depositing Lab: Sefi Rosenbluh
• Publication: Tuano et al Genome Biol. 2023 Mar 29;24(1):59. doi: 10.1186/s13059-023-02898-w.

Backbone

• Vector backbone: pLX311-GFP
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: GFP

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MEKDD
• Alt name: Dominant Negative MEK1
• Species: H. sapiens (human)
• Mutation: S218D, S222D
• GenBank ID: 5604
• Entrez Gene: MAP2K1 (a.k.a. CFC3, MAPKK1, MEK1, MEL, MKK1, PRKMK1)
• Promoter: E1Fa

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: cgtgaggctagcatcgattgatcaac
• 3′ sequencing primer: CTTTCTTGTACaaagtggttg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry