hPLD4-sgRNA-Cas9_mcherry
(Plasmid #199343)

• Purpose: encodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherry
• Depositing Lab: David Nemazee
• Publication: sgRNA plasmid (unpublished)

Backbone

• Vector backbone: lentiCRISPRv2
• Backbone manufacturer: adapted from addgene #99154
• Backbone size w/o insert (bp): 6800
• Total vector size (bp): 6800
• Vector type: Mammalian Expression, CRISPR
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Bleocin (Zeocin), 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hSpCas9
• Mutation: sgRNA: accagtagtatgaagccacg
• Promoter: human U6
• Tag / Fusion Protein:
  • P2A-mCherry

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: GAC TAT CAT ATG CTT ACC GT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The backbone was adapted from addgene #99154, where lentiviral elements were deleted.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry