pCRISPRi
(Plasmid #199808)

• Purpose: vector for constitutive CRISPRi-mediated gene knockdown in S. aureus
• Depositing Lab: Steve Salipante
• Depositing Organization: University of Washington
  Located in United States of America
• Publication: Long et al PLoS Pathog. 2024 Jul 11;20(7):e1012394. doi: 10.1371/journal.ppat.1012394. eCollection 2024 Jul.

Backbone

• Vector backbone: pCN50
• Backbone size w/o insert (bp): 5750
• Modifications to backbone: Site directed mutagenesis to remove BSAI site in AmpR gene. Replacement of the temperature sensitive S. aureus pT181cop-634 replicon with the wild type pT181 replicon. Vector modified to carry dead Cas9, and an sgRNA cassette. sgRNA has a GFP-expression construct cloned into its BSAI site to facilitate screening for successful cloning of targeting constructs (successful cloning events excise the GFP and colonies do not fluoresce) .
• Vector type: CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Chloramphenicol selection in S. aureus, Ampicillin selection in E. coli. Temperature sensitive replicon must be maintained at 32 degrees in S. aureus. Stable at 37 degrees in E. coli.
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: dCas9
• Insert Size (bp): 4297
• Promoter: P23

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: SbfI (not destroyed)
• 3′ cloning site: XmaI (not destroyed)
• 5′ sequencing primer: AAACCTGCAGGGCTGGCGGCCGCTGCATGatgacaaaaagagcaaaattttgataaaatagtattagTCGACAAAGGAGGCAAAAATGG
• 3′ sequencing primer: AAACCCGGGagtcttgaaaagcccctgtattact

Gene/Insert 2

• Gene/Insert name: sgRNA with GFP cassette
• Species: Synthetic
• Insert Size (bp): 1519
• Promoter: PRAB17 (sgRNA) and SarAP1 (GFP)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: KasI (not destroyed)
• 3′ cloning site: KasI (not destroyed)
• 5′ sequencing primer: AAAAATATGAACactctatcattg
• 3′ sequencing primer: CGGTGCCACTTTTTCAAGTT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See source publication for detailed protocols describing this vector's use.

DNA (Catalog # 199808-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 199808-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.