pSUP-(2xCouRS-tRNAopt)
(Plasmid #197930)

• Purpose: Machinery plasmid expressing constitutive and inducible 7HCou synthetase and cognate amber suppressing tRNA. Incorporates (7-hydroxy-4-coumarin-yl) ethylglycine
• Depositing Lab: Kenneth Johnson
• Publication: Dangerfield et al J Biol Chem. 2020 Dec 11;295(50):17265-17280. doi: 10.1074/jbc.RA120.015557. Epub 2020 Oct 5.

Backbone

• Vector backbone: pSUP-(MjYRS-6TRN)
• Total vector size (bp): 6266
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: CouRS
• Alt name: 7-HCou Aminoacyl tRNA synthetase
• Insert Size (bp): 921
• Promoter: glnS' and lambda(ts)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: GATTACGCGCAGACCAAAACGATC

Gene/Insert 2

• Gene/Insert name: tRNA opt
• Insert Size (bp): 77
• Promoter: proK

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: cgcatctcgggcagcgttgg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry