pTHY_P0021_T2c_BCD_0.45K
(Plasmid #200055)

• Purpose: Bicistronic RBS 0.45K Part
• Depositing Lab: Ross Thyer
• Publication: Jansen et al ACS Synth Biol. 2023 Jun 16;12(6):1608-1615. doi: 10.1021/acssynbio.3c00093. Epub 2023 May 30.

Backbone

• Vector backbone: pUC
• Total vector size (bp): 3277
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DB3.1
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BCD 0.45K
• Species: Synthetic
• Insert Size (bp): 167

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BsmBI (destroyed during cloning)
• 3′ cloning site: BsmBI (destroyed during cloning)
• 5′ sequencing primer: acagggctataaggtagatccggg
• 3′ sequencing primer: ctcttttctggaatttggtaccgagggtgacttc

Resource Information

• Supplemental Documents:
  • BCD 0.45k.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid encodes a part for use in a heirarchical golden gate plasmid assembly system. The part insert is a bicistronic translational control element for regulating translation of protein-coding genes in E. coli. It is flanked by sites for the type IIS restriction enzyme BsaI and yields 5' and 3' overhangs of GGAG and TATG respectively. The backbone contains a pUC origin, a TEM-1 ampicillin resistance marker, and a ccdB marker such that the part plasmid does not carry through into higher order plasmid assemblies. The plasmid must be propagated in an E. coli strain which is resistant to ccdB.

Please visit https://www.biorxiv.org/content/10.1101/2023.02.09.527918v1 for bioRxiv preprint.