GfaABC1D-Crym-BioID2-BioID2
(Plasmid #200070)

• Purpose: To study u-crystallin protein interactors
• Depositing Lab: Baljit Khakh
• Publication: Ollivier et al Nature. 2024 Mar;627(8003):358-366. doi: 10.1038/s41586-024-07138-0. Epub 2024 Feb 28.

Backbone

• Vector backbone: PZac2.1
• Backbone size w/o insert (bp): 3037
• Total vector size (bp): 7574
• Vector type: Mouse Targeting, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: GfaABC1D-Crym-BioID2-BioID2
• Alt name: GfaABC1D-Crym-BioID2
• Species: M. musculus (mouse)
• Insert Size (bp): 4087
• Promoter: GfaABC1D
• Tag / Fusion Protein:
  • HA-tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (destroyed during cloning)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: ataggctagcctcgaatgaagcgggcgccagc
• 3′ sequencing primer: gattcttggtcatctggcaagatcgagctcggatccac

Resource Information

• Supplemental Documents:
  • pZac2.1_gfABC1D_Crym-BioID2-BioID2-HA-WPRE-SV40.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry