pcDNA3.1-Vinculin_TurboID_Venus
(Plasmid
#200272)
-
PurposeExpressing vinculin with co-localization labeler TurboID and fluorescence reporter Venus
-
Depositing Lab
-
Depositing OrganizationDuke University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 200272-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 200272-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5379
- Total vector size (bp) 10280
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVinculin_TurboID_Venus
-
Alt nameVin-TurboID-Ven
-
SpeciesG. gallus (chicken), Synthetic
-
Insert Size (bp)4900
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GTAAACGGCCACAAGTTCAGC
- 3′ sequencing primer GACGTAGCCTTCGGGCAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 200272-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 200272-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-Vinculin_TurboID_Venus was a gift from Brenton Hoffman (Addgene plasmid # 200272 ; http://n2t.net/addgene:200272 ; RRID:Addgene_200272) -
For your References section:
Identifying constitutive and context-specific molecular-tension-sensitive protein recruitment within focal adhesions. Tao A, LaCroix AS, Shoyer TC, Venkatraman V, Xu KL, Feiger B, Hoffman BD. Dev Cell. 2023 Mar 10:S1534-5807(23)00074-6. doi: 10.1016/j.devcel.2023.02.015. 10.1016/j.devcel.2023.02.015 PubMed 36924770