pYG215
(Plasmid #200837)

• Purpose: Transcribes a glmZ' (1-146)-gfp fusion. gfp can be replaced via AgeI/XbaI-sites with gene of interest to release its RNA with a 5' monophosphate upon cleavage.
• Depositing Lab: Boris Görke
• Publication: Schilder et al Nucleic Acids Res. 2023 Mar 29:gkad226. doi: 10.1093/nar/gkad226.

Backbone

• Vector backbone: pSC101
• Backbone size w/o insert (bp): 6232
• Vector type: Bacterial Expression, Synthetic Biology
• Selectable markers: Chloramphenicol

Growth in Bacteria

• Bacterial Resistance(s): Tetracycline, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): E. coli TOP10
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: glmZ
• Alt name: sraJ
• Species: Escherichia coli str. K-12 substr. MG1655
• Insert Size (bp): 146
• Entrez Gene: glmZ (a.k.a. b4456, ECK3795, JWR0257, k19, psrA20, ryiA, sraJ)
• Promoter: P-LlacO-1
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AatII (unknown if destroyed)
• 3′ cloning site: AgeI (unknown if destroyed)
• 5′ sequencing primer: cgcgttggccgattcattaatgc
• 3′ sequencing primer: CCCGCAAGAGGCCCGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry