Z956
(Bacterial strain #200838)

• Purpose: Host strain for plasmids pYG205 and pYG215 or derivatives of the latter
• Depositing Lab: Boris Görke
• Publication: Schilder et al Nucleic Acids Res. 2023 Mar 29:gkad226. doi: 10.1093/nar/gkad226.

Backbone

• Vector backbone: n/a
• Vector type: This is a strain, not a plasmid

Growth in Bacteria

• Bacterial Resistance(s): None
• Growth Temperature: 37°C
• Growth Strain(s): Z956
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Genotype: MG1655 rph+, ilvG+, ΔlacZ, ΔrapZ, ΔglmZ, ΔglmY
• Species: Escherichia coli str. K-12 substr. MG1655
• Mutation: rapZ, glmZ and glmY are deleted to avoid interference with plasmid-encoded genes

Cloning Information

• Cloning method: Unknown

Resource Information

• Supplemental Documents:
  • PCR_S4197_Z956.pdf

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Primer to check deletions:
ΔrapZ (5' check primer: GGATACCGAAGGTACTCCGG; 3' check primer: CGTAAGAGCACTTCAGCGTC); ΔglmZ (5' check primer: GTGTAGGATCAAGCTCAGG; 3' check primer: CGGACGCCTACGATTACGC); ΔglmY (5' check primer: GTCTCTTTTTAGCGACACAGTGGC; 3' check primer: GGTGTTACTCTCGTCAGACGCG)