pVSL10
(Plasmid
#201182)
-
PurposeBst polymerase large fragment (BF) F710Y/D598A, His6-tagged, HRV 3C-cleavable
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201182 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET-28
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5298
- Total vector size (bp) 7101
-
Modifications to backbonePromoter is T5-lacO from pQE-30 (not T7), rnpB terminator, lacIq
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 30 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAvoid saturating overnight cultures. Perform overnights at 30 degC with 1% glucose.
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameBst polymerase large fragment (BF) F710Y/D598A
-
Alt nameDNA polymerase I large fragment from Geobacillus stearothermophilus
-
SpeciesGeobacillus stearothermophilus (formerly Bacillus stearothermophilus)
-
Insert Size (bp)1803
-
MutationF710Y D598A
- Promoter T5-lacO
-
Tags
/ Fusion Proteins
- His6 (N terminal on insert)
- HRV 3C protease cleavage site (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CGGATAACAATTTCACACAG
- 3′ sequencing primer GAGCACCGCCGCCGCAAGGAA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVSL10 was a gift from Jack Szostak (Addgene plasmid # 201182 ; http://n2t.net/addgene:201182 ; RRID:Addgene_201182) -
For your References section:
Trivalent rare earth metal cofactors confer rapid NP-DNA polymerase activity. Lelyveld VS, Fang Z, Szostak JW. Science. 2023 Oct 27;382(6669):423-429. doi: 10.1126/science.adh5339. Epub 2023 Oct 26. 10.1126/science.adh5339 PubMed 37883544