Skip to main content

pCMV- κLight1.3
(Plasmid #201223)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201223 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 201223-D50 50 μg of DNA in Tris buffer $495
DNA 201223-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCMV
  • Backbone size w/o insert (bp) 3988
  • Total vector size (bp) 6217
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    κLight1.3
  • Alt name
    kLight1.3
  • Species
    Synthetic
  • Insert Size (bp)
    2229
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ggtaggcgtgtacggtggg
  • 3′ sequencing primer gctattgctttatttgtaaccattataagctgcaataaac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV- κLight1.3 was a gift from Lin Tian (Addgene plasmid # 201223 ; http://n2t.net/addgene:201223 ; RRID:Addgene_201223)
  • For your References section:

    Unlocking opioid neuropeptide dynamics with genetically encoded biosensors. Dong C, Gowrishankar R, Jin Y, He XJ, Gupta A, Wang H, Sayar-Atasoy N, Flores RJ, Mahe K, Tjahjono N, Liang R, Marley A, Or Mizuno G, Lo DK, Sun Q, Whistler JL, Li B, Gomes I, Von Zastrow M, Tejeda HA, Atasoy D, Devi LA, Bruchas MR, Banghart MR, Tian L. Nat Neurosci. 2024 Jul 15. doi: 10.1038/s41593-024-01697-1. 10.1038/s41593-024-01697-1 PubMed 39009835