pHYX173
(Plasmid
#202817)
-
PurposePlasmid expressing the TEV protease, codon-optimized for Saccharomyces cerevisiae.
-
Depositing Lab
-
Depositing OrganizationINRAE, Centre de recherche de Versailles-Grignon
Located in France -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202817 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepHYX137 and pHYX138
- Backbone size w/o insert (bp) 7134
- Total vector size (bp) 7845
-
Modifications to backboneThe TEV protease gene was cloned into pHYX137 linearized by EcoRV. The resulting plasmid was then digested by SwaI. The pHYX138 was digested by PmeI. Both restriction reactions were then mixed and transformed into E. coli for in vivo assembly to give pHYX173.
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTEV protease
-
SpeciesSynthetic
-
Insert Size (bp)711
- Promoter ScPCK1
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCTGAAGAAGGAGCTCGCTC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHYX173 was a gift from Jean-Félix Dallery (Addgene plasmid # 202817 ; http://n2t.net/addgene:202817 ; RRID:Addgene_202817) -
For your References section:
Yeast-based heterologous production of the colletochlorin family of fungal secondary metabolites. Geistodt-Kiener A, Totozafy JC, Le Goff G, Vergne J, Sakai K, Ouazzani J, Mouille G, Viaud M, O'Connell RJ, Dallery JF. Metab Eng. 2023 Oct 18:S1096-7176(23)00142-8. doi: 10.1016/j.ymben.2023.10.002. 10.1016/j.ymben.2023.10.002 PubMed 37863177