pHD22Y/PfPRMT5 deletion
(Plasmid #203161)

• Purpose: for disruption of PfPRMT5 gene
• Depositing Lab: Liwang Cui
• Publication: Lucky et al Commun Biol. 2023 Jun 22;6(1):659. doi: 10.1038/s42003-023-05038-z.

Backbone

• Vector backbone: pHD22Y
• Backbone manufacturer: Wellems T lab
• Backbone size w/o insert (bp): 5818
• Total vector size (bp): 2151
• Modifications to backbone: No
• Vector type: Mammalian Expression
• Selectable markers: hdhfr

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PfPRMT5 fragment
• Species: Plasmodium falciprum 3D7
• Insert Size (bp): 1163
• GenBank ID: XM_001350285.1
• Promoter: No
• Tags / Fusion Proteins:
  • 3 myc tags (C terminal on backbone)
  • 3' UTR of P. berghei dihydrofolate reductase/thymidylate synthase (dhfr/ts) gene (pDT)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamH1 (not destroyed)
• 3′ cloning site: Not1 (not destroyed)
• 5′ sequencing primer: TATCATAAAATACCACAATGTGAAG
• 3′ sequencing primer: GCGGCCGCCTACCCTGAAGAAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

We cloned the N-terminal fragment of PfPRMT5, 3 myc tags, and 3' UTR region of P. berghei dihydrofolate reductase/thymidylate synthase (dhfr/ts) gene (pDT) into pHD22Y vector. This vector is used for disruption of the PfPRMT5 gene in the malaria parasite Plasmodium falciparum by single crossover.