Skip to main content

opto-E-cad GFP
(Plasmid #203327)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 203327 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 203327-D50 50 μg of DNA in Tris buffer $495
DNA 203327-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA3.1
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Photoswitchable - E-cadherin with GFP tag
  • Alt name
    opto-E-cad
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    3783
  • Mutation
    Addition of Aslov2 domain at T133 of human E-cadherin
  • GenBank ID
  • Entrez Gene
    CDH1 (a.k.a. Arc-1, BCDS1, CD324, CDHE, ECAD, LCAM, UVO)
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTGATGGAGGTCACAGCCACACTGGCGACCACCCTGGAACG
  • 3′ sequencing primer GTTCACATCATCGTCCGCGTCCGCTTCATCAATGTTTTCCG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The E-cadherin GFP plasmid was a gift from Jennifer Stow, Addgene plasmid #28009 The AsLOV2 domain was a gift from Brian Kuhlman and amplified from Addgene plasmid #40236

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    opto-E-cad GFP was a gift from Seraphine Wegner (Addgene plasmid # 203327 ; http://n2t.net/addgene:203327 ; RRID:Addgene_203327)
  • For your References section:

    Reversible photoregulation of cell-cell adhesions with opto-E-cadherin. Nzigou Mombo B, Bijonowski BM, Raab CA, Niland S, Brockhaus K, Muller M, Eble JA, Wegner SV. Nat Commun. 2023 Oct 9;14(1):6292. doi: 10.1038/s41467-023-41932-0. 10.1038/s41467-023-41932-0 PubMed 37813868