MYR-FR-C2D-EGFR
(Plasmid #179262)

• Purpose: Light-induced clustering of EGFR cytosolic domains
• Depositing Lab: Jared Toettcher
• Publication: Farahani et al Cell Rep. 2021 Dec 28;37(13):110181. doi: 10.1016/j.celrep.2021.110181.

Backbone

• Vector backbone: pHR
• Total vector size (bp): 13537
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: EGFR
• Alt name: ERBB
• Species: H. sapiens (human)
• Insert Size (bp): 1629
• Entrez Gene: EGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, PIG61, mENA)
• Promoter: SFFV
• Tags / Fusion Proteins:
  • FusionRed (N terminal on insert)
  • Cry2 PHR (N terminal on insert)
  • Myristoylation sequence (MYR) (N terminal on insert)
  • FUS (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ccgacagactgagtcgcccggg
• 3′ sequencing primer: ccagaggttgattatcgataagc

Resource Information

• Supplemental Documents:
  • pHR-MYR-FR-C2D-EGFR.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry