Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

MYR-FR-C2D-EGFR
(Plasmid #179262)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 179262 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    EGFR
  • Alt name
    ERBB
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1629
  • Entrez Gene
    EGFR (a.k.a. ERBB, ERBB1, ERRP, HER1, NISBD2, PIG61, mENA)
  • Promoter SFFV
  • Tags / Fusion Proteins
    • FusionRed (N terminal on insert)
    • Cry2 PHR (N terminal on insert)
    • Myristoylation sequence (MYR) (N terminal on insert)
    • FUS (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ccgacagactgagtcgcccggg
  • 3′ sequencing primer ccagaggttgattatcgataagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MYR-FR-C2D-EGFR was a gift from Jared Toettcher (Addgene plasmid # 179262 ; http://n2t.net/addgene:179262 ; RRID:Addgene_179262)
  • For your References section:

    Substratum stiffness regulates Erk signaling dynamics through receptor-level control. Farahani PE, Lemke SB, Dine E, Uribe G, Toettcher JE, Nelson CM. Cell Rep. 2021 Dec 28;37(13):110181. doi: 10.1016/j.celrep.2021.110181. 10.1016/j.celrep.2021.110181 PubMed 34965432