Skip to main content

Luc-SIRT1 mutant 3'UTR
(Plasmid #20380)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 20380 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 20380-D50 50 μg of DNA in Tris buffer $495
DNA 20380-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pMIR-REPORT
  • Backbone size w/o insert (bp) 6470
  • Vector type
    Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SIRT1
  • Alt name
    sirtuin (silent mating type information regulation 2 homolog) 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1420
  • Mutation
    mutant 3'UTR of SIRT1 (ACACCCACCAAGGACCATTAGTCCGAGA)
  • Entrez Gene
    SIRT1 (a.k.a. SIR2, SIR2L1, SIR2alpha)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer N/A
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

There are mismatches between Addgene's sequence and NCBI sequence for SIRT1 UTR. Deposit is aware of these changes and doesn't think they affect function.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Luc-SIRT1 mutant 3'UTR was a gift from Charles Lowenstein (Addgene plasmid # 20380 ; http://n2t.net/addgene:20380 ; RRID:Addgene_20380)
  • For your References section:

    miR-34a repression of SIRT1 regulates apoptosis. Yamakuchi M, Ferlito M, Lowenstein CJ. Proc Natl Acad Sci U S A. 2008 Sep 9. 105(36):13421-6. 10.1073/pnas.0801613105 PubMed 18755897