pAAV-sL7-Cre-HA-WPRE
(Plasmid
#204488)
-
PurposeFor production of driver AAV virus for Purkinje cell-specific expression
-
Depositing Lab
-
Depositing OrganizationPrinceton University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204488 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 5186
- Total vector size (bp) 6212
-
Vector typeMammalian Expression, Mouse Targeting, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre
-
SpeciesSynthetic
-
Insert Size (bp)1026
- Promoter sL7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CATGTTGGTTGATCTTCAAC
- 3′ sequencing primer AATCAACCTCTGGATTACAA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-sL7-Cre-HA-WPRE was a gift from Samuel Wang (Addgene plasmid # 204488 ; http://n2t.net/addgene:204488 ; RRID:Addgene_204488) -
For your References section:
Transcriptomic mapping uncovers Purkinje neuron plasticity driving learning. Chen X, Du Y, Broussard GJ, Kislin M, Yuede CM, Zhang S, Dietmann S, Gabel H, Zhao G, Wang SS, Zhang X, Bonni A. Nature. 2022 May;605(7911):722-727. doi: 10.1038/s41586-022-04711-3. Epub 2022 May 11. 10.1038/s41586-022-04711-3 PubMed 35545673