Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAV-hSyn-DIO-hM3D(Gq)-mCherry
(Plasmid #44361)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44361 Standard format: Plasmid sent in bacteria as agar stab 1 $75
AAV1 44361-AAV1 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid.
$380
AAV2 44361-AAV2 Virus (100 µL at titer ≥6×10¹² vg/mL) and Plasmid.
$380
AAV5 44361-AAV5 Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid.
$380
AAV8 44361-AAV8 Virus (100 µL at titer ≥ 4×10¹² vg/mL) and Plasmid.
$380
AAV9 44361-AAV9 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid.
$380
AAV Retrograde 44361-AAVrg Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid.
$380
AAV PHP.eB 44361-PHPeB Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid.
$380

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone size w/o insert (bp) 4824
  • Total vector size (bp) 7326
  • Vector type
    AAV ; Adeno Associated Viral Vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    hM3D(Gq)-mCherry
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2502
  • Promoter human Synapsin 1
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Asc I (not destroyed)
  • 3′ cloning site Nhe I (not destroyed)
  • 5′ sequencing primer tcgtgtcgtgcctgagagcg
  • 3′ sequencing primer GCATTAAAGCAGCGTATCCACATAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Information for AAV1 (Catalog # 44361-AAV1) ( Back to top )

Purpose

Ready-to-use AAV1 particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA.

Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

Information for AAV2 (Catalog # 44361-AAV2) ( Back to top )

Purpose

Ready-to-use AAV2 particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA.

Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 6×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV2
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

Data submitted about 44361-AAV2 by requesting scientist(s):

Information for AAV5 (Catalog # 44361-AAV5) ( Back to top )

Purpose

Ready-to-use AAV5 particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA.

Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

Data submitted about 44361-AAV5 by requesting scientist(s):

Information for AAV8 (Catalog # 44361-AAV8) ( Back to top )

Purpose

Ready-to-use AAV8 particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA.

Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 4×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
  • Envelope AAV8 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

Data submitted about 44361-AAV8 by requesting scientist(s):

Information for AAV9 (Catalog # 44361-AAV9) ( Back to top )

Purpose

Ready-to-use AAV9 particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA.

Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

Information for AAV Retrograde (Catalog # 44361-AAVrg) ( Back to top )

Purpose

Ready-to-use AAV Retrograde particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA.

Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
  • Serotype AAV retrograde (AAVrg)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

Data submitted about 44361-AAVrg by requesting scientist(s):

Information for AAV PHP.eB (Catalog # 44361-PHPeB) ( Back to top )

Purpose

Ready-to-use AAV PHP.eB particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA.

Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV were produced with the PHP.eB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, PHP.eB cap gene
    pUCmini-iCAP-PHP.eB (plasmid #103005)
  • Buffer PBS + 0.001% Pluronic F-68
  • Serotype PHPeB (plasmid #103005)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene mCherry (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.

Citation Information: When using the PHP.eB serotype in future publications, please acknowledge Viviana Gradinaru and cite Chan et al., Nat Neurosci, 20(8):1172-1179. Pubmed.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-hSyn-DIO-hM3D(Gq)-mCherry was a gift from Bryan Roth (Addgene plasmid # 44361 ; http://n2t.net/addgene:44361 ; RRID:Addgene_44361)

    For viral preps, please replace (Addgene plasmid # 44361) in the above sentence with: (Addgene viral prep # 44361-AAV1), (Addgene viral prep # 44361-AAV2), (Addgene viral prep # 44361-AAV5), (Addgene viral prep # 44361-AAV8), (Addgene viral prep # 44361-AAV9), (Addgene viral prep # 44361-AAVrg), or (Addgene viral prep # 44361-PHPeB)

  • For your References section:

    Rapid, reversible activation of AgRP neurons drives feeding behavior in mice. Krashes MJ, Koda S, Ye C, Rogan SC, Adams AC, Cusher DS, Maratos-Flier E, Roth BL, Lowell BB. J Clin Invest. 2011 Apr;121(4):1424-8. doi: 10.1172/JCI46229. 10.1172/JCI46229 PubMed 21364278