pcDNA-tdMCP-msfGFP(V206K)-GBI
(Plasmid
#205163)
-
Purposeexpress tdMCP-msfGFP(V206K)-GBI
-
Depositing Lab
-
Depositing OrganizationZhejiang University
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 205163 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 205163-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 205163-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA
- Total vector size (bp) 7043
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametdMCP-msfGFP(V206K)-GBI
-
SpeciesSynthetic
-
Insert Size (bp)1674
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bytdMCP is amplified from Addene plasmid #64541 and the msfGFP(V206K)-GB1 fragment was amplified from plasmid "pcDNA-puro-kozak-scFv-GCN4-HAtag-msfGFP(V206K)-GBI "
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 205163-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 205163-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA-tdMCP-msfGFP(V206K)-GBI was a gift from Weirui Ma (Addgene plasmid # 205163 ; http://n2t.net/addgene:205163 ; RRID:Addgene_205163) -
For your References section:
Enhanced single RNA imaging reveals dynamic gene expression in live animals. Hu Y, Xu J, Gao E, Fan X, Wei J, Ye B, Xu S, Ma W. Elife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. 10.7554/eLife.82178 PubMed 36867026
Map uploaded by the depositor.
