pcDNA-puro-TagBFP-β-ACTIN-3′UTR-8xMS2
(Plasmid
#205160)
-
Purposeexpress β-ACTIN-3′UTR-8xMS2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 205160 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA
- Total vector size (bp) 7642
-
Vector typeMammalian Expression, Bacterial Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameβ-ACTIN-3′UTR-24xMS2
-
SpeciesSynthetic
-
Insert Size (bp)1834
- Promoter CMV
-
Tag
/ Fusion Protein
- tagBFP (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCACATATAGATCCAAGAAACCCGC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bythe β-ACTIN coding sequence with a 3′UTR of 373 bp was PCR amplified from the cDNA of HEK293T/17 cells and the 8xMS2 fragment was synthesized
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA-puro-TagBFP-β-ACTIN-3′UTR-8xMS2 was a gift from Weirui Ma (Addgene plasmid # 205160 ; http://n2t.net/addgene:205160 ; RRID:Addgene_205160) -
For your References section:
Enhanced single RNA imaging reveals dynamic gene expression in live animals. Hu Y, Xu J, Gao E, Fan X, Wei J, Ye B, Xu S, Ma W. Elife. 2023 Mar 3;12:e82178. doi: 10.7554/eLife.82178. 10.7554/eLife.82178 PubMed 36867026