-
PurposePITCh dTAG donor vector for FKBP_F36V-2xHA-P2A-Puro knock-in into the C-terminus of the human BRD4 locus.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 91796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCRIS-PITChv2 (addgene #63672)
-
Backbone manufacturerTakashi Yamamoto lab
- Backbone size w/o insert (bp) 4579
- Total vector size (bp) 5738
-
Modifications to backboneA C-terminal dTAG cassette for endogenous protein degradation replaced the EGFP cassette in the original pCRIS-PITChv2 plasmid (addgene #63672)
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFKBP_F36V-2xHA-P2A-Puro
-
SpeciesSynthetic
-
MutationPhenylalanine 36 to valine in FKBP12
- Promoter Promotorless
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tcgcccttaattgtgagcgga
- 3′ sequencing primer gaaaggacagtgggagtggca
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byTakashi Yamamoto lab (addgene #63672)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See:
Sakuma, T., Nakade, S., Sakane, Y., Suzuki, K.-I. & Yamamoto, T. MMEJ-assisted gene knock-in using TALENs and CRISPR-Cas9 with the PITCh systems. Nat Protoc 11, 118–133 (2016).
for the original backbone and general cloning protocol.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRIS-PITChv2-dTAG-Puro (BRD4) was a gift from James Bradner & Behnam Nabet (Addgene plasmid # 91796 ; http://n2t.net/addgene:91796 ; RRID:Addgene_91796) -
For your References section:
The dTAG system for immediate and target-specific protein degradation. Nabet B, Roberts JM, Buckley DL, Paulk J, Dastjerdi S, Yang A, Leggett AL, Erb MA, Lawlor MA, Souza A, Scott TG, Vittori S, Perry JA, Qi J, Winter GE, Wong KK, Gray NS, Bradner JE. Nat Chem Biol. 2018 May;14(5):431-441. doi: 10.1038/s41589-018-0021-8. Epub 2018 Mar 26. 10.1038/s41589-018-0021-8 PubMed 29581585