pHR-LS
(Plasmid #205438)

• Purpose: Expression of Gaussia luciferase (gLuc) and spectinomycin resistance (Spec) genes
• Depositing Lab: Masamichi Kamihira
• Publication: Huang et al J Biosci Bioeng. 2021 Nov;132(5):469-478. doi: 10.1016/j.jbiosc.2021.07.006. Epub 2021 Aug 19.

Backbone

• Vector backbone: pBluescript II KS (+)
• Backbone manufacturer: Stratagene
• Vector type: Cre/Lox, Luciferase ; Chlamydomonas Expression
• Selectable markers: spectinomycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Gaussia luciferase gene
• Alt name: gLuc
• Promoter: Heat shock protein 70A (HSP70A)/ribulose bisphosphate carboxylase small subunit 2 (RBCS2) hybrid promoter

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (unknown if destroyed)
• 3′ cloning site: SpeI (unknown if destroyed)
• 5′ sequencing primer: CCCAGTCACGACGTTGTAAAACG
• 3′ sequencing primer: CGTTCGCCTCCATTTCCTTG

Gene/Insert 2

• Gene/Insert name: spectinomycin resistance gene
• Alt name: Spec
• Promoter: Heat shock protein 70A (HSP70A)/ribulose bisphosphate carboxylase small subunit 2 (RBCS2) hybrid promoter

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AvrII (unknown if destroyed)
• 3′ cloning site: KpnI (unknown if destroyed)
• 5′ sequencing primer: TGGTCTCCAGCAGGTCGTTG
• 3′ sequencing primer: AGCGGATAACAATTTCACACAGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry