pHS1182
(Plasmid
#205964)
-
PurposeNZ_CP025815 DinG HNH crRNA expression in pCOLADuet-1
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 205964 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepColADuet-1
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDinG HNH crRNA
-
gRNA/shRNA sequenceGAGAAGTCATTTAATAAGGCCACTGTTAAA
-
SpeciesSulfitobacter sp. JL08, NZ_CP025815
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHS1182 was a gift from Feng Zhang (Addgene plasmid # 205964 ; http://n2t.net/addgene:205964 ; RRID:Addgene_205964) -
For your References section:
Uncovering the functional diversity of rare CRISPR-Cas systems with deep terascale clustering. Altae-Tran H, Kannan S, Suberski AJ, Mears KS, Demircioglu FE, Moeller L, Kocalar S, Oshiro R, Makarova KS, Macrae RK, Koonin EV, Zhang F. Science. 2023 Nov 24;382(6673):eadi1910. doi: 10.1126/science.adi1910. Epub 2023 Nov 23. 10.1126/science.adi1910 PubMed 37995242
