pLV-CMV-KIF2C
(Plasmid
#205994)
-
PurposeOver-expression of GFP-KIF2c
-
Depositing Lab
-
Depositing OrganizationUniversity Medical Center Groningen
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 205994 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 205994-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 205994-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepLVX
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 8134
- Total vector size (bp) 11089
-
Modifications to backboneReplaced pTight-promoter by CMV-promoter
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKIF2c
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2178
-
GenBank IDNM_006845.4
-
Entrez GeneKIF2C (a.k.a. CT139, KNSL6, MCAK)
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer AAGCGCCTCCCCTACCCGGT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBakhoum, S. F.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Bakhoum, S. F. et al. Chromosomal instability drives metastasis through a cytosolic DNA
response. Nature 553, 467–472 (2018).
DNA (Catalog # 205994-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 205994-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV-CMV-KIF2C was a gift from Floris Foijer (Addgene plasmid # 205994 ; http://n2t.net/addgene:205994 ; RRID:Addgene_205994) -
For your References section:
cGAS-STING drives the IL-6-dependent survival of chromosomally instable cancers. Hong C, Schubert M, Tijhuis AE, Requesens M, Roorda M, van den Brink A, Ruiz LA, Bakker PL, van der Sluis T, Pieters W, Chen M, Wardenaar R, van der Vegt B, Spierings DCJ, de Bruyn M, van Vugt MATM, Foijer F. Nature. 2022 Jul;607(7918):366-373. doi: 10.1038/s41586-022-04847-2. Epub 2022 Jun 15. 10.1038/s41586-022-04847-2 PubMed 35705809