Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Tubulin-mGreenLantern
(Plasmid #164460)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 164460 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Unspecified
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mGreenLantern
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    717
  • Mutation
    Clover-F64L/S72A/E124V/N149K/I167T/S175G/A206K/L221K/F223R/G232D
  • Promoter CMV
  • Tag / Fusion Protein
    • Tubulin (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BshTI (not destroyed)
  • 3′ cloning site Xho1 (not destroyed)
  • 5′ sequencing primer CMV-F
  • 3′ sequencing primer GACATGGACGAGCTGTACAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tubulin-mGreenLantern was a gift from Gregory Petsko (Addgene plasmid # 164460 ; http://n2t.net/addgene:164460 ; RRID:Addgene_164460)
  • For your References section:

    mGreenLantern: a bright monomeric fluorescent protein with rapid expression and cell filling properties for neuronal imaging. Campbell BC, Nabel EM, Murdock MH, Lao-Peregrin C, Tsoulfas P, Blackmore MG, Lee FS, Liston C, Morishita H, Petsko GA. Proc Natl Acad Sci U S A. 2020 Dec 1;117(48):30710-30721. doi: 10.1073/pnas.2000942117. Epub 2020 Nov 18. 10.1073/pnas.2000942117 PubMed 33208539