Skip to main content
Addgene
Open Menu

hPAX8_gRNA_pSpCas9(BB)-2A-GFP
(Plasmid #206005)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206005 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-GFP
  • Backbone manufacturer
    Feng Zhang
  • Backbone size w/o insert (bp) 9289
  • Total vector size (bp) 9292
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PAX8 gRNA
  • gRNA/shRNA sequence
    GTTGACCATCTGTAGTTGCCA
  • Species
    H. sapiens (human)
  • Entrez Gene
    PAX8 (a.k.a. PAX-8)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)
  • 5′ sequencing primer n/a
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Feng Zhang

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hPAX8_gRNA_pSpCas9(BB)-2A-GFP was a gift from Darrell Kotton (Addgene plasmid # 206005 ; http://n2t.net/addgene:206005 ; RRID:Addgene_206005)

  • For your References section:

    Derivation of transplantable human thyroid follicular epithelial cells from induced pluripotent stem cells. Undeutsch HJ, Posabella A, Alber AB, Bawa PS, Villacorta-Martin C, Wang F, Ikonomou L, Kotton DN, Hollenberg AN. Stem Cell Reports. 2024 Dec 10;19(12):1690-1705. doi: 10.1016/j.stemcr.2024.10.004. Epub 2024 Nov 7. 10.1016/j.stemcr.2024.10.004 PubMed 39515316
Related items: