Cav2.2 W391A pcDNA3
(Plasmid #206085)

• Purpose: expression of rabbit Cav2.2 calcium channel with a mutation (W391A) in the ?1-interacting domain (AID) in the I-II loop of Cav2.2 that prevents Beta subunit binding
• Depositing Lab: Annette Dolphin
• Publication: Leroy et al J Neurosci. 2005 Jul 27;25(30):6984-96.

Backbone

• Vector backbone: pcDNA3
• Backbone manufacturer: Invitrogen Life Technologies
• Backbone size w/o insert (bp): 5446
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: cacna1b
• Alt name: Cav2.2 alpha1B
• Species: O. cuniculus (rabbit)
• Insert Size (bp): 7094
• Mutation: W391A
• Entrez Gene: CACNA1B
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: unknown (unknown if destroyed)
• 5′ sequencing primer: CTGGCTAACTAGAGAACC
• 3′ sequencing primer: GCATTTAGGTGACACTATAG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Yasuo Mori

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

5' end of Cav2.2 DNA is very GC rich