Cav2.2 D122A HA pCAGGS
(Plasmid
#206097)
-
Purposeexpression of rabbit Cav2.2 calcium channel with an exofacial double HA tag in domain II and a D122A mutation that disrupts the interaction with ?2?-1
-
Depositing Lab
-
Depositing OrganizationUniversity College London
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 206097 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 206097-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 206097-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAGGS
-
Backbone manufacturerPMID 11397804
- Backbone size w/o insert (bp) 4890
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecacna1b
-
Alt nameCav2.2 alpha1B
-
SpeciesO. cuniculus (rabbit)
-
Insert Size (bp)7160
-
MutationD122A
-
Entrez GeneCACNA1B
- Promoter CMV/B-actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CTCTGCTAACCATGTTCATGC
- 3′ sequencing primer CTGATAGGCAGCCTGCACCTG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byYasuo Mori
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' end of DNA is very GC rich
DNA (Catalog # 206097-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 206097-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Cav2.2 D122A HA pCAGGS was a gift from Annette Dolphin (Addgene plasmid # 206097 ; http://n2t.net/addgene:206097 ; RRID:Addgene_206097) -
For your References section:
The alpha(2)delta-like Protein Cachd1 Increases N-type Calcium Currents and Cell Surface Expression and Competes with alpha(2)delta-1. Dahimene S, Page KM, Kadurin I, Ferron L, Ho DY, Powell GT, Pratt WS, Wilson SW, Dolphin AC. Cell Rep. 2018 Nov 6;25(6):1610-1621.e5. doi: 10.1016/j.celrep.2018.10.033. 10.1016/j.celrep.2018.10.033 PubMed 30404013