Skip to main content

GFP Cav2.2 HA D665A pcDNA3
(Plasmid #206113)

  • Purpose
    expression of rabbit Cav2.2 with a N-terminal GFP tag and an exofacial double HA tag in domain II and a D665A mutation that allows trafficking to the plasma membrane but channel is not functional
  • Depositing Lab
  • Depositing Organization
    University College London
    Located in United Kingdom of Great Britain and Northern Ireland
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206113 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen Life Technologies
  • Backbone size w/o insert (bp) 5446
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cacna1b
  • Alt name
    Cav2.2 alpha1B
  • Species
    O. cuniculus (rabbit)
  • Insert Size (bp)
    7857
  • Mutation
    D665A
  • Entrez Gene
    CACNA1B
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CTGGCTAACTAGAGAACC
  • 3′ sequencing primer GCATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Yasuo Mori

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' end of DNA is very GC rich

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP Cav2.2 HA D665A pcDNA3 was a gift from Annette Dolphin (Addgene plasmid # 206113 ; http://n2t.net/addgene:206113 ; RRID:Addgene_206113)