Skip to main content
Addgene
Open Menu

cacna2d1 R241A D491A HA pcDNA3
(Plasmid #206109)

Print
  • Purpose
    expression of rat alpha2delta-1 calcium channel auxillary subunit with a single HA tag inserted after aa549 and with R421A and D491A mutations that both disrupt Gabapentin binding
  • Depositing Lab
    Annette Dolphin
  • Depositing Organization
    University College London
    Located in United Kingdom of Great Britain and Northern Ireland
  • Publication
    Dolphin Lab Plasmids 2023 (unpublished) ( How to cite )
  • Sequence Information

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206109 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 206109-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 206109-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen Life Technologies
  • Backbone size w/o insert (bp) 5446
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    cacna2d1
  • Alt name
    alpha2delta-1
  • Species
    R. norvegicus (rat)
  • Mutation
    R241A D491A
  • Entrez Gene
    Cacna2d1 (a.k.a. CCHLA2, Cacna2, DHSCCA)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer CTGGCTAACTAGAGAACC
  • 3′ sequencing primer GCATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Kevin Campbell

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    cacna2d1 R241A D491A HA pcDNA3 was a gift from Annette Dolphin (Addgene plasmid # 206109 ; http://n2t.net/addgene:206109 ; RRID:Addgene_206109)
Related items:
Commonly requested with: