Skip to main content

AAV-KP1
(Plasmid #206504)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 206504 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    AAV2 rep, partial p5 in generic backbone
  • Backbone size w/o insert (bp) 5116
  • Total vector size (bp) 7333
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable ;
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KP1 capsid
  • Species
    adeno-associated virus
  • Insert Size (bp)
    2214
  • GenBank ID
    MN428626.1
  • Promoter p5

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Swa I (not destroyed)
  • 3′ cloning site Age I (not destroyed)
  • 5′ sequencing primer TGGATGACTGCATCTTTGAA
  • 3′ sequencing primer GCAGGTTTAAACGAATTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV-KP1 was a gift from Mark Kay (Addgene plasmid # 206504 ; http://n2t.net/addgene:206504 ; RRID:Addgene_206504)
  • For your References section:

    Using a barcoded AAV capsid library to select for clinically relevant gene therapy vectors. Pekrun K, De Alencastro G, Luo QJ, Liu J, Kim Y, Nygaard S, Galivo F, Zhang F, Song R, Tiffany MR, Xu J, Hebrok M, Grompe M, Kay MA. JCI Insight. 2019 Nov 14;4(22). pii: 131610. doi: 10.1172/jci.insight.131610. 10.1172/jci.insight.131610 PubMed 31723052