pcDNA3.1_hHNF4alpha
(Plasmid #206878)

• Purpose: The ORF of HNF4α (variant 2) cDNA amplified from the RT human liver RNA was cloned at the Bam HI/XbaI sites of the pcDNA3.1(+), the mammalian expression vector.
• Depositing Labs: Catharine Ross, Reza Zolfaghari
• Depositing Organization: Pennsylvania State University
  Located in the United States of America
• Publication: Zolfaghari et al J Cell Biochem. 2014 Oct;115(10):1740-51. doi: 10.1002/jcb.24839.

Backbone

• Vector backbone: pcDNA3.1(+)
• Backbone size w/o insert (bp): 5428
• Total vector size (bp): 6853
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Human hepatocyte nuclear factor 4 alpha
• Alt name: HNF4alpha variant 2
• Species: H. sapiens (human)
• Insert Size (bp): 1425
• GenBank ID: NM_000457
• Entrez Gene: HNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: XbaI (unknown if destroyed)
• 5′ sequencing primer: ttggatccgccaccatgcgactctccaaaaccc
• 3′ sequencing primer: tttctagactagataacttcctgcttgg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Zolfaghari R, Bonzo JA, Gonzalez FJ, Ross AC. Hepatocyte Nuclear Factor 4α (HNF4α) Plays a Controlling Role in Expression of the Retinoic Acid Receptor β (RARβ) Gene in Hepatocytes. Int J Mol Sci. 2023 May 11;24(10):8608. doi: 10.3390/ijms24108608. PMID: 37239961; PMCID: PMC10218549.

DNA (Catalog # 206878-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 206878-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.