pmirGLO-3'UTR mouse Il13 5xBoxB
(Plasmid
#207128)
-
PurposeTethered luciferase reporter for mouse Il13 BoxB
-
Depositing Lab
-
Depositing OrganizationInstitute for Research in Biomedicine, Switzerland
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207128 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 207128-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 207128-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmirGLO Dual-Luciferase miRNA Target Expression Vector
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 7362
- Total vector size (bp) 8091
-
Modifications to backboneadded EcoRI and SmaI restriction enzyme sites in the multiple cloning site
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameInterleukin 13 (Il13) 3'UTR
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)741
-
GenBank IDNM_008355.3
-
Entrez GeneIl13 (a.k.a. Il-13)
-
Tag
/ Fusion Protein
- 5xBoxB (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 207128-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 207128-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmirGLO-3'UTR mouse Il13 5xBoxB was a gift from Silvia Monticelli (Addgene plasmid # 207128 ; http://n2t.net/addgene:207128 ; RRID:Addgene_207128) -
For your References section:
The mRNA methyltransferase Mettl3 modulates cytokine mRNA stability and limits functional responses in mast cells. Leoni C, Bataclan M, Ito-Kureha T, Heissmeyer V, Monticelli S. Nat Commun. 2023 Jun 29;14(1):3862. doi: 10.1038/s41467-023-39614-y. 10.1038/s41467-023-39614-y PubMed 37386028
