FKBP12-CB2mutx2-mTagBFP2-HAx2
(Plasmid #207147)

• Purpose: Tandem mutant calcium-buffer with rapalog dimerizer
• Depositing Lab: Antony Galione
• Publication: Davis et al EMBO J. 2020 Jul 15;39(14):e104058. doi: 10.15252/embj.2019104058. Epub 2020 Jun 8.

Backbone

• Vector backbone: pEGFP
• Backbone size w/o insert (bp): 4000
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Calbindin-2
• Species: H. sapiens (human)
• Insert Size (bp): 813
• Mutation: E40Q, E87Q, E131Q, E175Q, E219Q
• GenBank ID: BC015484
• Entrez Gene: CALB2 (a.k.a. CAB29, CAL2, CR)
• Promoter: CMV
• Tags / Fusion Proteins:
  • FKBP12 (N terminal on insert)
  • mTagBFP2 (C terminal on insert)
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CAACGGGACTTTCCAAAATG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Resource Information

• Supplemental Documents:
  • FKBP12-CB2mutx2-mTagBFP2-HA.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry