pET23A-Fucosidase-E1_10125-Ruminococcus_gnavus-His
(Plasmid #207665)

• Purpose: Expresses fucosidase E1_10125 from Ruminococcus gnavus in BL21 cells, purified using His-tag
• Depositing Lab: Robert de Vries
• Publication: Spruit et al bioRxiv 2023.12.15.571923

Backbone

• Vector backbone: PET23A
• Backbone manufacturer: Merck Millipore Novagen
• Backbone size w/o insert (bp): 3605
• Total vector size (bp): 5252
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: For production of DNA, use JM109. For expression of the fucosidase, use BL21. Grow at 37 degrees Celsius until OD 0.8-1.0, induce with IPTG, then grow at room temperature.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Fucosidase E1_10125
• Species: Ruminococcus gnavus
• Insert Size (bp): 1647
• Mutation: amino acids 34-584 were used
• GenBank ID: WP_268803839.1
• Promoter: T7 promoter
• Tag / Fusion Protein:
  • His-tag (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: T7 Fwd TAATACGACTCACTATAGGG
• 3′ sequencing primer: GATATAGTTCCTCCTTTCAGC

Resource Information

• Supplemental Documents:
  • pet23a-fucosidase-for-addgene.gb
• A portion of this plasmid was derived from a plasmid made by: Insert was synthesized by GenScript.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2023.12.15.571923 for bioRxiv preprint.