Skip to main content

GW1-ARSeNL
(Plasmid #207873)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 207873 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 207873-D50 50 μg of DNA in Tris buffer $495
DNA 207873-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    GW1
  • Backbone size w/o insert (bp) 5271
  • Total vector size (bp) 6873
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ARSeNL
  • Alt name
    mScarlet-BsEpsilon-NanoLuc
  • Species
    Synthetic
  • Insert Size (bp)
    1602
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGAATCGGAGTGAGTGC
  • 3′ sequencing primer CAAATGTGGTATGGCTGATT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GW1-ARSeNL was a gift from Mathew Tantama (Addgene plasmid # 207873 ; http://n2t.net/addgene:207873 ; RRID:Addgene_207873)
  • For your References section:

    Ratiometric BRET Measurements of ATP with a Genetically-Encoded Luminescent Sensor. Min SH, French AR, Trull KJ, Tat K, Varney SA, Tantama M. Sensors (Basel). 2019 Aug 10;19(16). pii: s19163502. doi: 10.3390/s19163502. 10.3390/s19163502 PubMed 31405152