pDisplay-GRAB-gDA3m-IRES-mCherry-CAAX
(Plasmid
#208692)
-
PurposeExpresses the genetically-encoded fluorescent dopamine (DA) sensor GRAB_gDA3m and a membrane-localized mcherry in mammalian cells
-
Depositing Lab
-
Depositing OrganizationPeking University
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208692 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 208692-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 208692-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepDisplay
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPCR activation based dopamine (DA) sensor GRAB_gDA3m
-
Alt nameGRAB_gDA3m
-
Alt namegDA3m
-
SpeciesH. sapiens (human)
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGGCGGTAGGCGTGTA
- 3′ sequencing primer CCTCACATTGCCAAAAGACG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.08.24.554559 for biorxiv preprint
DNA (Catalog # 208692-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 208692-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDisplay-GRAB-gDA3m-IRES-mCherry-CAAX was a gift from Yulong Li (Addgene plasmid # 208692 ; http://n2t.net/addgene:208692 ; RRID:Addgene_208692) -
For your References section:
Improved green and red GRAB sensors for monitoring dopaminergic activity in vivo. Zhuo Y, Luo B, Yi X, Dong H, Miao X, Wan J, Williams JT, Campbell MG, Cai R, Qian T, Li F, Weber SJ, Wang L, Li B, Wei Y, Li G, Wang H, Zheng Y, Zhao Y, Wolf ME, Zhu Y, Watabe-Uchida M, Li Y. Nat Methods. 2023 Nov 30. doi: 10.1038/s41592-023-02100-w. 10.1038/s41592-023-02100-w PubMed 38036855