pDisplay-NE2h-IRES-mCherry-CAAX
(Plasmid
#208691)
-
PurposeExpresses the genetically-encoded fluorescent norepinephrine (NE) sensor GRAB_NE2h and a membrane-localized mcherry in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208691 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDisplay
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5193
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPCR activation based norepinephrine (NE) sensor GRAB_NE2h
-
Alt nameGRAB_NE2h
-
Alt nameNE2h
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3345
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGGCGGTAGGCGTGTA
- 3′ sequencing primer CCTCACATTGCCAAAAGACG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.06.22.546075v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDisplay-NE2h-IRES-mCherry-CAAX was a gift from Yulong Li (Addgene plasmid # 208691 ; http://n2t.net/addgene:208691 ; RRID:Addgene_208691)