Skip to main content

pGL-Rbl2
(Plasmid #20885)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 20885 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 20885-D50 50 μg of DNA in Tris buffer $495
DNA 20885-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pGL3-Control
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5256
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rbl2 (p130) 3'UTR
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1400
  • GenBank ID
    NM_011250
  • Entrez Gene
    Rbl2 (a.k.a. PRB2, RBR-2, Rb2, p130)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GGAAAACTCGACGCAAGA
  • 3′ sequencing primer CACATTTGTAGAGGTTTTACTTGCT
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL-Rbl2 was a gift from Robert Blelloch (Addgene plasmid # 20885 ; http://n2t.net/addgene:20885 ; RRID:Addgene_20885)
  • For your References section:

    Embryonic stem cell-specific microRNAs regulate the G1-S transition and promote rapid proliferation. Wang Y, Baskerville S, Shenoy A, Babiarz JE, Baehner L, Blelloch R. Nat Genet. 2008 Dec . 40(12):1478-83. 10.1038/ng.250 PubMed 18978791