AAV-EGFP-APOBEC1-YTHmut
(Plasmid #209320)

• Purpose: AAV packaging vector containing a EGFP-P2A expression cassette, APOBEC1-YTHmut cassette.
• Depositing Lab: Magdalena Koziol
• Publication: Feng et al bioRxiv 2023.12.06.570314

Backbone

• Vector backbone: CAG-EGFP
• Backbone manufacturer: Gift from Minmin Luo's lab
• Backbone size w/o insert (bp): 5436
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: APOBEC1-YTHmut-HA
• Species: H. sapiens (human), R. norvegicus (rat)
• Insert Size (bp): 1332
• Mutation: YTH domain lacks AA 385-409 comprising the m6A-binding region
• Tag / Fusion Protein:
  • HA (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: EGFP-C_seq_F: catggtcctgctggagttcgtg
• 3′ sequencing primer: WPRE-seq_R:cagcgtatccacatagcgta

Resource Information

• Supplemental Documents:
  • AAV-EGFP-APOBEC1-YTHmut GenBank file
• A portion of this plasmid was derived from a plasmid made by: Kate Meyer (Addgene plasmid # 131637)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

5' cloning sites:EGFP_P2A_clone_F: gcatggacgagctgtacaaggccactaacttctccctP2A_clone_F: gccactaacttctccctgttgaaacaagcaggggatgtcgaagagaatcccgggccaP2A_APOBEC1_clone_F: gaagagaatcccgggccaatgagctcagagactggccc3' cloning site:WPRE-HindIII-SD-HA-clone-R: tccagaggttgattatcgataagcttttaggcgtagtcgggcacgtcgt

Please visit https://www.biorxiv.org/content/10.1101/2023.12.06.570314v1 for bioRxiv preprint.