pCRISPR-mcBEST
(Plasmid
#209416)
-
PurposePlasmid for multiplexed cytosine base editing in streptomycetes
-
Depositing Lab
-
Depositing OrganizationDanmarks Tekniske Universitet
Located in Denmark -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209416 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 209416-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 209416-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGM1190
- Total vector size (bp) 13213
-
Vector typeCRISPR, Synthetic Biology
-
Selectable markersApramycin
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrowth at 30 C in streptomycetes
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCodon optimized APOBEC1-nCas9-UGI fusion protein
-
Alt namecytosine base editor
-
SpeciesSynthetic
-
GenBank IDnone
- Promoter base editing cassette: PtipA ; sgRNAs: PkasO*
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site NheI (unknown if destroyed)
- 5′ sequencing primer caacatgctgtgcggtgttg
- 3′ sequencing primer gaccctgatccaccagagca
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namecsy4 from Pseudomonas aeruginosa PAO1
-
SpeciesPseudomonas aeruginosa PAO1
-
GenBank IDWP_003162920.1
- Promoter csy4: PermE*
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer none
- 3′ sequencing primer none
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 209416-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 209416-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR-mcBEST was a gift from Tilmann Weber (Addgene plasmid # 209416 ; http://n2t.net/addgene:209416 ; RRID:Addgene_209416) -
For your References section:
Systems Analysis of Highly Multiplexed CRISPR-Base Editing in Streptomycetes. Whitford CM, Gren T, Palazzotto E, Lee SY, Tong Y, Weber T. ACS Synth Biol. 2023 Aug 18;12(8):2353-2366. doi: 10.1021/acssynbio.3c00188. Epub 2023 Jul 4. 10.1021/acssynbio.3c00188 PubMed 37402223
Map uploaded by the depositor.
