-
PurposeC to T base editor for actinomycetes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 125689 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGM1190
- Backbone size w/o insert (bp) 6971
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namestreptomyces codon optimized spCas9n (D10A), modified sgRNA casette, streptomyces codon optimized rAPOBEC1
-
Alt nameand streptomyces codon optimized UGI
-
gRNA/shRNA sequenceGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT
-
SpeciesOther
- Promoter ermE*/tipA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/582403v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR-cBEST was a gift from Tilmann Weber (Addgene plasmid # 125689 ; http://n2t.net/addgene:125689 ; RRID:Addgene_125689) -
For your References section:
Highly efficient DSB-free base editing for streptomycetes with CRISPR-BEST. Tong Y, Whitford CM, Robertsen HL, Blin K, Jorgensen TS, Klitgaard AK, Gren T, Jiang X, Weber T, Lee SY. Proc Natl Acad Sci U S A. 2019 Oct 8;116(41):20366-20375. doi: 10.1073/pnas.1913493116. Epub 2019 Sep 23. 10.1073/pnas.1913493116 PubMed 31548381