-
PurposeGene knockdown for actinomycetes
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 125687 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGM1190
- Backbone size w/o insert (bp) 6971
-
Vector typeCRISPR, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Apramycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namestreptomyces codon optimized spdCas9, sgRNA casette
-
Alt nameD10A, H840A of spCas9
-
gRNA/shRNA sequenceGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT
-
SpeciesOther
- Promoter ermE*/tipA
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR-dCas9 was a gift from Tilmann Weber (Addgene plasmid # 125687 ; http://n2t.net/addgene:125687 ; RRID:Addgene_125687) -
For your References section:
CRISPR-Cas9 Based Engineering of Actinomycetal Genomes. Tong Y, Charusanti P, Zhang L, Weber T, Lee SY. ACS Synth Biol. 2015 Sep 18;4(9):1020-9. doi: 10.1021/acssynbio.5b00038. Epub 2015 Apr 7. 10.1021/acssynbio.5b00038 PubMed 25806970