Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCRISPR-Cas9
(Plasmid #125686)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 125686 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGM1190
  • Backbone size w/o insert (bp) 6971
  • Vector type
    CRISPR, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Apramycin, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    streptomyces codon optimized spCas9, sgRNA casette
  • gRNA/shRNA sequence
    GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTT
  • Species
    Other
  • Promoter ermE*/tipA

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPR-Cas9 was a gift from Tilmann Weber (Addgene plasmid # 125686)
  • For your References section:

    CRISPR-Cas9 Based Engineering of Actinomycetal Genomes. Tong Y, Charusanti P, Zhang L, Weber T, Lee SY. ACS Synth Biol. 2015 Sep 18;4(9):1020-9. doi: 10.1021/acssynbio.5b00038. Epub 2015 Apr 7. 10.1021/acssynbio.5b00038 PubMed 25806970