ECibN
(Plasmid
#209670)
-
PurposeExpresses E-cadherin fused with eGFP, CIB1, and Split-TurboID-N in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of California, Davis
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 209670 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 8600
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameE-Cadherin
-
Alt nameCDH1
-
SpeciesCanis lupus familiaris
-
Insert Size (bp)2700
-
GenBank IDNC_051809
-
Entrez GeneCDH1 (a.k.a. Cadherin-1, Uvomorulin)
- Promoter CMV
-
Tags
/ Fusion Proteins
- eGFP (C terminal on insert)
- Split-TurboID-N (C terminal on insert)
- CIB1 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer gcaaatgggcggtaggcgtg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ECibN was a gift from Sanjeevi Sivasankar (Addgene plasmid # 209670 ; http://n2t.net/addgene:209670 ; RRID:Addgene_209670) -
For your References section:
Light-activated BioID - an optically activated proximity labeling system to study protein-protein interactions. Shafraz O, Davis CMO, Sivasankar S. J Cell Sci. 2023 Oct 1;136(19):jcs261430. doi: 10.1242/jcs.261430. Epub 2023 Oct 11. 10.1242/jcs.261430 PubMed 37756605