Skip to main content

Bet1-mCherry
(Plasmid #209848)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 209848 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pmCherry-N1
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Bet1
  • Alt name
    Golgi vesicular membrane-trafficking protein p18
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_001317739.1
  • Entrez Gene
    BET1 (a.k.a. HBET1)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer TAACAACTCCGCCCCATT
  • 3′ sequencing primer CACCTTGAAGCGCATGAACT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Bet1-mCherry was a gift from Geert van den Bogaart (Addgene plasmid # 209848 ; http://n2t.net/addgene:209848 ; RRID:Addgene_209848)
  • For your References section:

    Congenital disorder of glycosylation caused by starting site-specific variant in syntaxin-5. Linders PTA, Gerretsen ECF, Ashikov A, Vals MA, de Boer R, Revelo NH, Arts R, Baerenfaenger M, Zijlstra F, Huijben K, Raymond K, Muru K, Fjodorova O, Pajusalu S, Ounap K, Ter Beest M, Lefeber D, van den Bogaart G. Nat Commun. 2021 Oct 28;12(1):6227. doi: 10.1038/s41467-021-26534-y. 10.1038/s41467-021-26534-y PubMed 34711829