pUC57-ITR2-H1-GFP sgRNA Gollum Target 4- eCMV- SaSp-3XFLAG-SV40NLS-ITR2
(Plasmid #210748)

• Purpose: Coding for SaSp Cas9 alongside Gollum sgRNA targeting GFP Target 4
• Depositing Lab: Vincent Dion
• Publication: Dion Lab Plasmids 2023 (unpublished)

Backbone

• Vector backbone: pUC57
• Backbone manufacturer: Genscript
• Vector type: Mammalian Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: SaSp Cas9
• Species: Synthetic
• Mutation: N-terminal Sa Cas9, C-terminal Sp Cas9
• Promoter: eCMV
• Tag / Fusion Protein:
  • 3xFLAG, SV40 NLS, PolyA signal (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: n/a

Gene/Insert 2

• Gene/Insert name: Gollum sgRNA GFP Target 4
• Alt name: gRNA target: GGGCGAGGAGCTGTTCACCGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCAAAATGCCGTGTTTAACTTGAAAAAGTGT
• Species: Synthetic
• Promoter: H1

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: n/a

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Genscript

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry