Skip to main content
Addgene
Open Menu

pHTN-HaloTag_DCAF12:1-453
(Plasmid #210966)

Print

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 210966 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
Add to Cart
DNA 210966-D50 50 μg of DNA in Tris buffer $495 *
Add to Cart
DNA 210966-D100 100 μg of DNA in Tris buffer $585 *
Add to Cart

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pHTN-HaloTag
  • Backbone manufacturer
    Promega
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DCAF12:M1-S453
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1359
  • Mutation
    R131Q natural variant (VAR_035322)
  • Entrez Gene
    DCAF12 (a.k.a. CT102, TCC52, WDR40A, MGC1058, KIAA1892, DKFZp434O125)
  • Promoter CMV
  • Tag / Fusion Protein
    • HaloTag (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ACCTGATCGGCAGCGAGATC
  • 3′ sequencing primer CTTATCATGTCTGCTCGAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Mammalian Gene Collection (BC063823.1)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

5' Cloning Site: EcoR1 (not destroyed), 3' Cloning Site: Xba1 (not destroyed).N terminal tag: maeigtgfpfdphyvevlgermhyvdvgprdgtpvlflhgnptssyvwrniiphvapthrciapdligmgksdkpdlgyffddhvrfmdafiealgleevvlvihdwgsalgfhwakrnpervkgiafmefirpiptwdewpefaretfqafrttdvgrkliidqnvfiegtlpmgvvrpltevemdhyrepflnpvdreplwrfpnelpiagepanivalveeymdwlhqspvpkllfwgtpgvlippaeaarlakslpnckavdigpglnllqednpdligseiarwlstleisgepttedlyfqsdnaiasef.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHTN-HaloTag_DCAF12:1-453 was a gift from Cheryl Arrowsmith (Addgene plasmid # 210966 ; http://n2t.net/addgene:210966 ; RRID:Addgene_210966)

  • For your References section:

    A Target Class Ligandability Evaluation of WD40 Repeat-Containing Proteins. Ackloo S, Li F, Szewczyk M, Seitova A, Loppnau P, Zeng H, Xu J, Ahmad S, Arnautova YA, Baghaie AJ, Beldar S, Bolotokova A, Centrella PA, Chau I, Clark MA, Cuozzo JW, Dehghani-Tafti S, Disch JS, Dong A, Dumas A, Feng JA, Ghiabi P, Gibson E, Gilmer J, Goldman B, Green SR, Guie MA, Guilinger JP, Harms N, Herasymenko O, Houliston S, Hutchinson A, Kearnes S, Keefe AD, Kimani SW, Kramer T, Kutera M, Kwak HA, Lento C, Li Y, Liu J, Loup J, Machado RAC, Mulhern CJ, Perveen S, Righetto GL, Riley P, Shrestha S, Sigel EA, Silva M, Sintchak MD, Slakman BL, Taylor RD, Thompson J, Torng W, Underkoffler C, von Rechenberg M, Walsh RT, Watson I, Wilson DJ, Wolf E, Yadav M, Yazdi AK, Zhang J, Zhang Y, Santhakumar V, Edwards AM, Barsyte-Lovejoy D, Schapira M, Brown PJ, Halabelian L, Arrowsmith CH. J Med Chem. 2025 Jan 23;68(2):1092-1112. doi: 10.1021/acs.jmedchem.4c02010. Epub 2024 Nov 4. 10.1021/acs.jmedchem.4c02010 PubMed 39495097
Related items:
Commonly requested with: